d. melanogaster λ-zap ii cdna library  (Agilent technologies)

Journal: Biomolecules

Article Title: Cloning and Characterization of Drosophila melanogaster Juvenile Hormone Epoxide Hydrolases (JHEH) and Their Promoters

doi: 10.3390/biom12070991

Figure Lengend Snippet: Genomic DNA sequence of jheh including intron (black lines) exons (white colored squares) and promoters (gray colored squares) of jheh 1, jheh 2 and jheh 3. Arrow follows the 5′ to 3′direction of D. melanogaster genome.

Article Snippet: The actin probe cDNA was prepared by PCR using D. melanogaster λ-Zap II cDNA library (Stratagene) with primer pair DB657 (forward) 5′ CAGGTGATCACCATTGGCAACGGAGCG 3′ ( t m 62 °C) and DB658 (reverse) 5′ CCTGCTTCGAGATCCACATCTGCTG 3′ ( t m 63 °C).

Techniques: Sequencing

Journal: Biomolecules

Article Title: Cloning and Characterization of Drosophila melanogaster Juvenile Hormone Epoxide Hydrolases (JHEH) and Their Promoters

doi: 10.3390/biom12070991

Figure Lengend Snippet: Northern blot analyses of D. melanogaster jheh 1 t ( a ), jheh 2 ( b ) and jheh 3 ( c ) transcripts in the head gut (HT), gut (G), ovary (O), fat body (FB) and total insect extract (T) of female D. melanogaster . Blots were hybridized with specific probes for each transcript . Actin probe was used to show even transfer to the blot. The Northern blot analyses were repeated twice, showing similar results.

Article Snippet: The actin probe cDNA was prepared by PCR using D. melanogaster λ-Zap II cDNA library (Stratagene) with primer pair DB657 (forward) 5′ CAGGTGATCACCATTGGCAACGGAGCG 3′ ( t m 62 °C) and DB658 (reverse) 5′ CCTGCTTCGAGATCCACATCTGCTG 3′ ( t m 63 °C).

Techniques: Northern Blot

Journal: Biomolecules

Article Title: Cloning and Characterization of Drosophila melanogaster Juvenile Hormone Epoxide Hydrolases (JHEH) and Their Promoters

doi: 10.3390/biom12070991

Figure Lengend Snippet: D. melanogaster flies that were transformed with jheh 3 promoter pJHEH#3L3 (colored green) in pCaSpeR-AUG-βgal behind lac Z (colored magenta) upper bar. Arrows point to β-galactosidase activity in the abdomen ( a ), in the thorax ( b ), in the leg muscle and upper abdomen next to the thorax ( c ) and the ventral part of the abdomen ( d ).

Article Snippet: The actin probe cDNA was prepared by PCR using D. melanogaster λ-Zap II cDNA library (Stratagene) with primer pair DB657 (forward) 5′ CAGGTGATCACCATTGGCAACGGAGCG 3′ ( t m 62 °C) and DB658 (reverse) 5′ CCTGCTTCGAGATCCACATCTGCTG 3′ ( t m 63 °C).

Techniques: Transformation Assay, Activity Assay

Journal: Biomolecules

Article Title: Cloning and Characterization of Drosophila melanogaster Juvenile Hormone Epoxide Hydrolases (JHEH) and Their Promoters

doi: 10.3390/biom12070991

Figure Lengend Snippet: In vivo metabolism of [12- 3 H]JH IIIA in female D. melanogaster .

Article Snippet: The actin probe cDNA was prepared by PCR using D. melanogaster λ-Zap II cDNA library (Stratagene) with primer pair DB657 (forward) 5′ CAGGTGATCACCATTGGCAACGGAGCG 3′ ( t m 62 °C) and DB658 (reverse) 5′ CCTGCTTCGAGATCCACATCTGCTG 3′ ( t m 63 °C).

Techniques: In Vivo

Journal: Pancreatology

Article Title: Conservation of the TGF?/Labial Homeobox Signaling Loop in Endoderm-Derived Cells between Drosophila and Mammals

doi: 10.1159/000276895

Figure Lengend Snippet: Expression of labial-like genes in rat pancreas containing the highly conserved homeobox domain. a A pancreas cDNA library was used as a template in a PCR amplification using degenerate primers for the highly conserved homeobox domain encoding for the sequences EKEFHFN and IWFQRRMK, which resulted in the amplification of two different fragments encoding the homeobox motifs for the Labial-like rat HoxA1 and HoxB1 paralogs. The sequences obtained from the PCR-amplified cDNAs, rat PCR-A and rat PCR-B, were used for FASTA analysis against sequences deposited in the GenBank database using GCG analysis software. Since the homeobox domain of many members of this family is highly conserved, the sequences were compared at the DNA level to make more meaningful comparisons. Note that rat PCR-A compared closely (98%) with the homeobox-encoding domain of the murine HoxA1 and that rat PCR-B was almost identical to the human HoxB1. b Nucleotide and deduced amino acid sequences of the rat HoxA1 gene is depicted. The full-length coding sequence of rat HoxA1 was obtained by pancreas cDNA and genomic library screening. Nucleotides are numbered at left, amino acids are numbered at right, and the initiator and termination codons are boxed. The homeobox motif is boxed. Arrows represent the donor and acceptor sites for an alternative splicing event which leads to a frameshift in translation and a premature termination (represented in bold type, see fig. ​fig.4).4). The peptide region used to generate a polyclonal antibody against the homeobox-containing HoxA1 is underlined with asterisks. Overall, rat HoxA1 is 96% similar to the mouse homolog at the DNA level and almost identical (99%) at the protein level as determined using FASTA analysis (GCG, Madison, Wisc., USA).

Article Snippet: A rat pancreas cDNA library (λ ZAP II, Stratagene, La Jolla, Calif., USA) was screened using the PCR-amplified HoxA1 cDNA as a probe as previously described [ 26 ].

Techniques: Expressing, cDNA Library Assay, Amplification, Software, Sequencing, Library Screening

Journal: Pancreatology

Article Title: Conservation of the TGF?/Labial Homeobox Signaling Loop in Endoderm-Derived Cells between Drosophila and Mammals

doi: 10.1159/000276895

Figure Lengend Snippet: Amplification of alternatively spliced forms of HoxA1 from pancreatic populations. a To better determine the size of the HoxA1 transcript, 40 μg of total RNA from AR41P cells were separated further by agarose gel electrophoresis and used for Northern blot analysis. HoxA1 was expressed in these cells as a 2.2-kb and a 2.0-kb transcript. b PCR analysis of alternatively spliced forms of HoxA1 from pancreatic populations. Primers were designed against the rat HoxA1, which flank the intron/exon boundaries within the gene and used in PCR amplification against cDNA derived from the full-length rat HoxA1 cDNA, AR4IP cells, and adult rat pancreas. The upper arrow indicates the expected size product of a full-length homeobox-encoding mRNA, while the lower arrow designates the expected size of an alternatively spliced message previously reported by LaRosa and Gudas [33]. Note that the pancreatic populations, AR41P and adult rat pancreas, express both the full-length rat HoxA1 (A) and an alternatively spliced transcript (B). c Schematic diagram of the alternatively spliced forms of HoxA1. The cDNAs amplified in b were cloned, sequenced and shown to encode a homeobox-containing (HoxA1/box+) (‘A’) and a homeobox-less (HoxA1/box–) (‘B’) protein. This latter product is a result of a frameshift which occurs at the site of splicing, causing a premature termination of the protein sequence (also see fig. ​fig.11).

Article Snippet: A rat pancreas cDNA library (λ ZAP II, Stratagene, La Jolla, Calif., USA) was screened using the PCR-amplified HoxA1 cDNA as a probe as previously described [ 26 ].

Techniques: Amplification, Agarose Gel Electrophoresis, Northern Blot, Derivative Assay, Clone Assay, Sequencing